Standard PCR
Basic information
| Latin name | Acanthaster cf. solaris |
| Common name | Corallivorous Seastar |
| Broad taxonomic group | echinoderm |
| eDNA source | water |
| assay type | standard PCR |
| gene/region | Cytochrome c oxidase subunit I |
| primer F (5′ – 3′) | TCCGACTACCCGGACGCCTATAC |
| primer R (5′ – 3′) | AGTGGTTCGCTGGGAAGTGAAGG |
| latest publication year | 2017 |
| Number of citations | 1 |
| Citation | 69 |
Validation score and minimum criteria
Validation level |
2 |
|
| Variable blocks | Minimum criteria | Score |
| in silico analysis | target species | 1 |
| target tissue testing | target tissue | 1 |
| target tissue PCR | primer (and probe) sequences reported | 1 |
| comprehensive reporting of PCR conditions | DNA extract volume in PCR | 1 |
| in vitro testing on closely related non-target species | any in vitro testing | 1 |
| extraction method performed on environmental DNA samples | method of extraction | 1 |
| concentration of eDNA from environmental sample | filter type or precipitation chemicals | 0 |
| detection obtained from environmental samples | detection from an environmental sample (artificial or natural habitat) | 1 |
| limit of detection (LOD) established | LOD determined | 0 |
| extensive field testing of environmental samples | multiple locations or multiple samples | 1 |
| in vitro testing on co-occurring non-target species | any advanced in vitro testing | 1 |
| comprehensive specificity testing | non-co-occurring / closely related species checked from in silico | 0 |
| detection probability estimation from statistical modelling | any effort made towards detection probability estimation | 0 |
| understanding ecological and physical factors influencing eDNA in the environment | any factor influencing eDNA in the environment tested | 0 |
Detailed validation scores
| database reported | 1 |
| target species | 1 |
| software name | 1 |
| software parameters | 1 |
| how many mismatches etc. | 1 |
| where are mismatches located 3′ 5′ | 1 |
| list potential non target organisms that may cause problems | 0 |
| closely related | 0 |
| co-occurring | 0 |
| target tissue | 1 |
| tissue source | 1 |
| geographic scope | 1 |
| number of individuals the tissue was extracted from | 0 |
| tested on more than one haplotype | 0 |
| DNA concentration of the target extracts | 1 |
| primer (and probe) sequences reported | 1 |
| thermocycling conditions | 1 |
| check of amplification success | 1 |
| amplification confirmed by sequencing | 0 |
| gene / region reported | 1 |
| probe (if applicable; 5′-3′) | NA |
| 5′ reporter dye (e.g. FAM, VIC, TET, NED) | NA |
| internal quencher (in the middle of the probe sequence; e.g. ZEN) | NA |
| 3′ quencher (ZEN, BHQ1, BHQ2, IBFQ, TAMARA) | NA |
| TaqMan MGBNFQ (minor groove binder non fluorescent quencher) (yes/no) | NA |
| volume | 1 |
| primer concentration | 1 |
| use of commercial Master Mix | 1 |
| use of custom Master Mix | 0 |
| MgCl2 concentration | NA |
| dNTP concentration | NA |
| buffer type and concentration | NA |
| enzyme type and concentration | 1 |
| enhancer chemicals (additives TMAC, BSA, DIMSO….) | 0 |
| DNA extract volume in PCR | 1 |
| cycler model | 0 |
| annealing time | 1 |
| annealing temp | 1 |
| cycles | 1 |
| technical replication | 0 |
| optimization of PCR conditions | 0 |
| how many per species | 1 |
| geographic origin | 1 |
| tissue source (fresh or old) | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| basic geographic scope | 1 |
| unidirectional lab flow | 0 |
| extensive geographic testing | 1 |
| method of extraction | 1 |
| modifications from established protocol | 1 |
| lysate volume | 0 |
| extraction negative control | 0 |
| elution volume | 1 |
| verification of DNA extraction | 1 |
| volume weight of environmental sample | 0 |
| filter type | 0 |
| pore size | 0 |
| surface area diameter | 0 |
| pressure used for filtration | 0 |
| filter preservation | 0 |
| precipitation chemicals added | NA |
| centrifugation force and time for precipitation | NA |
| temperature of precipitation | NA |
| storage between collection and processing | 0 |
| “field” blanks | 1 |
| criteria to determine detection | 0 |
| sample type (e.g., water sediment) | 1 |
| artificial habitat | 1 |
| natural habitat | 1 |
| target DNA spiked into sample type | 0 |
| environmental variables recorded | 0 |
| sequence validation of positive field samples | 0 |
| determined limit of detection | 0 |
| method of establishment | NA |
| multiple replicates of standard curve | NA |
| multiple locations | 1 |
| site where species is not there | 1 |
| site where species is there | 1 |
| site where species was there historically | 0 |
| multiple samples at each site | 0 |
| environmental gradients (e.g., abiotic biotic conditions) | 0 |
| different known target species densities | 0 |
| testing against data from traditional methods | 0 |
| inhibition testing | 0 |
| geographic region tested | 1 |
| source of species occurrence information | 0 |
| multiple samples per species | 0 |
| geographic origin of tissue samples | 0 |
| tissue source | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| non co-occurring closely related species checked from in silico | 0 |
| justify non-verified results from in silico (geographic realistic) | 0 |
| non-target amplification checked via sequencing | 0 |
| sampling through time | 0 |
| sampling spatially | 0 |
| statistical modelling | 0 |
| occupancy modelling | 0 |
| parameters and variables of model reported | 0 |
| know origin (e.g., shedding rate) | 0 |
| state | 0 |
| degradation rate | 0 |
| transport | 0 |
qPCR
Basic information
| Latin name | Acanthaster cf. solaris |
| Common name | Corallivorous Seastar |
| Broad taxonomic group | echinoderm |
| eDNA source | water |
| assay type | qPCR |
| gene/region | Cytochrome c oxidase subunit I |
| primer F (5′ – 3′) | TCCGACTACCCGGACGCCTATAC |
| primer R (5′ – 3′) | AGTGGTTCGCTGGGAAGTGAAGG |
| probe (5′ – 3′) | CTATCTCATCCATAGGCAGCAC |
| 5′ reporter dye | FAM |
| PCR chemisty | Bioline Sensifast Probe No-Rox master mix |
| latest publication year | 2017 |
| Number of citations | 1 |
| Citation | 69 |
Validation score and minimum criteria
Validation level |
2 |
|
| Variable blocks | Minimum criteria | Score |
| in silico analysis | target species | 1 |
| target tissue testing | target tissue | 1 |
| target tissue PCR | primer (and probe) sequences reported | 1 |
| comprehensive reporting of PCR conditions | DNA extract volume in PCR | 1 |
| in vitro testing on closely related non-target species | any in vitro testing | 1 |
| extraction method performed on environmental DNA samples | method of extraction | 1 |
| concentration of eDNA from environmental sample | filter type or precipitation chemicals | 0 |
| detection obtained from environmental samples | detection from an environmental sample (artificial or natural habitat) | 1 |
| limit of detection (LOD) established | LOD determined | 1 |
| extensive field testing of environmental samples | multiple locations or multiple samples | 1 |
| in vitro testing on co-occurring non-target species | any advanced in vitro testing | 1 |
| comprehensive specificity testing | non-co-occurring / closely related species checked from in silico | 0 |
| detection probability estimation from statistical modelling | any effort made towards detection probability estimation | 0 |
| understanding ecological and physical factors influencing eDNA in the environment | any factor influencing eDNA in the environment tested | 0 |
Detailed validation scores
| database reported | 1 |
| target species | 1 |
| software name | 1 |
| software parameters | 1 |
| how many mismatches etc. | 1 |
| where are mismatches located 3′ 5′ | 1 |
| list potential non target organisms that may cause problems | 0 |
| closely related | 0 |
| co-occurring | 0 |
| target tissue | 1 |
| tissue source | 1 |
| geographic scope | 1 |
| number of individuals the tissue was extracted from | 0 |
| tested on more than one haplotype | 0 |
| DNA concentration of the target extracts | 1 |
| primer (and probe) sequences reported | 1 |
| thermocycling conditions | 1 |
| check of amplification success | 1 |
| amplification confirmed by sequencing | 0 |
| gene / region reported | 1 |
| probe (if applicable; 5′-3′) | 1 |
| 5′ reporter dye (e.g. FAM, VIC, TET, NED) | 1 |
| internal quencher (in the middle of the probe sequence; e.g. ZEN) | NA |
| 3′ quencher (ZEN, BHQ1, BHQ2, IBFQ, TAMARA) | 0 |
| TaqMan MGBNFQ (minor groove binder non fluorescent quencher) (yes/no) | 0 |
| volume | 1 |
| primer concentration | 1 |
| use of commercial Master Mix | 1 |
| use of custom Master Mix | 0 |
| MgCl2 concentration | NA |
| dNTP concentration | NA |
| buffer type and concentration | NA |
| enzyme type and concentration | 1 |
| enhancer chemicals (additives TMAC, BSA, DIMSO….) | 0 |
| DNA extract volume in PCR | 1 |
| cycler model | 1 |
| annealing time | 1 |
| annealing temp | 1 |
| cycles | 1 |
| technical replication | 0 |
| optimization of PCR conditions | 0 |
| how many per species | 1 |
| geographic origin | 1 |
| tissue source (fresh or old) | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| basic geographic scope | 1 |
| unidirectional lab flow | 0 |
| extensive geographic testing | 1 |
| method of extraction | 1 |
| modifications from established protocol | 1 |
| lysate volume | 0 |
| extraction negative control | 0 |
| elution volume | 1 |
| verification of DNA extraction | 1 |
| volume weight of environmental sample | 0 |
| filter type | 0 |
| pore size | 0 |
| surface area diameter | 0 |
| pressure used for filtration | 0 |
| filter preservation | 0 |
| precipitation chemicals added | NA |
| centrifugation force and time for precipitation | NA |
| temperature of precipitation | NA |
| storage between collection and processing | 0 |
| “field” blanks | 1 |
| criteria to determine detection | 0 |
| sample type (e.g., water sediment) | 1 |
| artificial habitat | 1 |
| natural habitat | 1 |
| target DNA spiked into sample type | 0 |
| environmental variables recorded | 0 |
| sequence validation of positive field samples | 0 |
| determined limit of detection | 1 |
| method of establishment | 1 |
| multiple replicates of standard curve | 0 |
| multiple locations | 1 |
| site where species is not there | 1 |
| site where species is there | 1 |
| site where species was there historically | 0 |
| multiple samples at each site | 0 |
| environmental gradients (e.g., abiotic biotic conditions) | 0 |
| different known target species densities | 0 |
| testing against data from traditional methods | 0 |
| inhibition testing | 0 |
| geographic region tested | 1 |
| source of species occurrence information | 0 |
| multiple samples per species | 0 |
| geographic origin of tissue samples | 0 |
| tissue source | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| non co-occurring closely related species checked from in silico | 0 |
| justify non-verified results from in silico (geographic realistic) | 0 |
| non-target amplification checked via sequencing | 0 |
| sampling through time | 0 |
| sampling spatially | 0 |
| statistical modelling | 0 |
| occupancy modelling | 0 |
| parameters and variables of model reported | 0 |
| know origin (e.g., shedding rate) | 0 |
| state | 0 |
| degradation rate | 0 |
| transport | 0 |
dPCR
Basic information
| Latin name | Acanthaster cf. solaris |
| Common name | Corallivorous Seastar |
| Broad taxonomic group | echinoderm |
| eDNA source | water |
| assay type | dPCR |
| gene/region | Cytochrome c oxidase subunit I |
| primer F (5′ – 3′) | TCCGACTACCCGGACGCCTATAC |
| primer R (5′ – 3′) | AGTGGTTCGCTGGGAAGTGAAGG |
| probe (5′ – 3′) | CTATCTCATCCATAGGCAGCAC |
| 5′ reporter dye | FAM |
| PCR chemisty | BioRad ddPCR Supermix for probes |
| latest publication year | 2018 |
| Number of citations | 1 |
| Citation | 69 & 280 |
Validation score and minimum criteria
Validation level |
1 |
|
| Variable blocks | Minimum criteria | Score |
| in silico analysis | target species | 1 |
| target tissue testing | target tissue | 1 |
| target tissue PCR | primer (and probe) sequences reported | 1 |
| comprehensive reporting of PCR conditions | DNA extract volume in PCR | 0 |
| in vitro testing on closely related non-target species | any in vitro testing | 1 |
| extraction method performed on environmental DNA samples | method of extraction | 1 |
| concentration of eDNA from environmental sample | filter type or precipitation chemicals | 1 |
| detection obtained from environmental samples | detection from an environmental sample (artificial or natural habitat) | 1 |
| limit of detection (LOD) established | LOD determined | 1 |
| extensive field testing of environmental samples | multiple locations or multiple samples | 1 |
| in vitro testing on co-occurring non-target species | any advanced in vitro testing | 1 |
| comprehensive specificity testing | non-co-occurring / closely related species checked from in silico | 0 |
| detection probability estimation from statistical modelling | any effort made towards detection probability estimation | 1 |
| understanding ecological and physical factors influencing eDNA in the environment | any factor influencing eDNA in the environment tested | 0 |
Detailed validation scores
| database reported | 1 |
| target species | 1 |
| software name | 1 |
| software parameters | 1 |
| how many mismatches etc. | 1 |
| where are mismatches located 3′ – 5′ | 1 |
| list potential non target organisms that may cause problems | 0 |
| closely related | 0 |
| co-occurring | 0 |
| target tissue | 1 |
| tissue source | 1 |
| geographic scope | 1 |
| number of individuals the tissue was extracted from | 0 |
| tested on more than one haplotype | 0 |
| DNA concentration of the target extracts | 1 |
| primer (and probe) sequences reported | 1 |
| thermocycling conditions | 1 |
| check of amplification success | 1 |
| amplification confirmed by sequencing | 0 |
| gene / region reported | 1 |
| probe (if applicable; 5′-3′) | 1 |
| 5′ reporter dye (e.g. FAM, VIC, TET, NED) | 1 |
| internal quencher (in the middle of the probe sequence; e.g. ZEN) | NA |
| 3′ quencher (ZEN, BHQ1, BHQ2, IBFQ, TAMARA) | 0 |
| TaqMan MGBNFQ (minor groove binder non fluorescent quencher) (yes/no) | 0 |
| volume | 1 |
| primer concentration | 1 |
| use of commercial Master Mix | 1 |
| use of custom Master Mix | 0 |
| MgCl2 concentration | NA |
| dNTP concentration | NA |
| buffer type and concentration | NA |
| enzyme type and concentration | 0 |
| enhancer chemicals (additives TMAC, BSA, DIMSO….) | 0 |
| DNA extract volume in PCR | 0 |
| cycler model | 1 |
| annealing time | 1 |
| annealing temp | 1 |
| cycles | 1 |
| technical replication | 0 |
| optimization of PCR conditions | 0 |
| how many per species | 1 |
| geographic origin | 1 |
| tissue source (fresh or old) | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| basic geographic scope | 1 |
| unidirectional lab flow | 0 |
| extensive geographic testing | 1 |
| method of extraction | 1 |
| modifications from established protocol | 1 |
| lysate volume | 1 |
| extraction negative control | 1 |
| elution volume | 1 |
| verification of DNA extraction | 1 |
| volume weight of environmental sample | 1 |
| filter type | 1 |
| pore size | 1 |
| surface area diameter | 0 |
| pressure used for filtration | 0 |
| filter preservation | 0 |
| precipitation chemicals added | NA |
| centrifugation force and time for precipitation | NA |
| temperature of precipitation | NA |
| storage between collection and processing | 1 |
| “field” blanks | 1 |
| criteria to determine detection | 0 |
| sample type (e.g., water sediment) | 1 |
| artificial habitat | 1 |
| natural habitat | 1 |
| target DNA spiked into sample type | 0 |
| environmental variables recorded | 0 |
| sequence validation of positive field samples | 0 |
| determined limit of detection | 1 |
| method of establishment | 1 |
| multiple replicates of standard curve | 0 |
| multiple locations | 1 |
| site where species is not there | 1 |
| site where species is there | 1 |
| site where species was there historically | 0 |
| multiple samples at each site | 1 |
| environmental gradients (e.g., abiotic biotic conditions) | 0 |
| different known target species densities | 1 |
| testing against data from traditional methods | 1 |
| inhibition testing | 0 |
| geographic region tested | 1 |
| source of species occurrence information | 0 |
| multiple samples per species | 0 |
| geographic origin of tissue samples | 0 |
| tissue source | 1 |
| non-target amplification checked via sequencing | 0 |
| DNA concentration | 1 |
| non co-occurring closely related species checked from in silico | 0 |
| justify non-verified results from in silico (geographic realistic) | 0 |
| non-target amplification checked via sequencing | 0 |
| sampling through time | 0 |
| sampling spatially | 1 |
| statistical modelling | 1 |
| occupancy modelling | 0 |
| parameters and variables of model reported | 0 |
| know origin (e.g., shedding rate) | 0 |
| state | 0 |
| degradation rate | 0 |
| transport | 0 |